Review





Similar Products

cetp antibody / cholesteryl ester transfer protein  (NSJ Bioreagents)
91
NSJ Bioreagents cetp antibody / cholesteryl ester transfer protein
Cetp Antibody / Cholesteryl Ester Transfer Protein, supplied by NSJ Bioreagents, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cetp antibody / cholesteryl ester transfer protein/product/NSJ Bioreagents
Average 91 stars, based on 1 article reviews
cetp antibody / cholesteryl ester transfer protein - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier
snp cetp c 9615318 10  (Thermo Fisher)
86
Thermo Fisher snp cetp c 9615318 10
Sociodemographic Characteristics and <t> CETP </t> rs708272 Genotypes.
Snp Cetp C 9615318 10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/snp cetp c 9615318 10/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
snp cetp c 9615318 10 - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier
cetp gene  (Human Protein Atlas)
90
Human Protein Atlas cetp gene
Genotypic and allelic frequencies of −629C/A and 277C/T polymorphisms of <t> CETP gene </t> and their Hardy Weinberg Equilibrium analysis ( n = 402).
Cetp Gene, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cetp gene/product/Human Protein Atlas
Average 90 stars, based on 1 article reviews
cetp gene - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
anacetrapib, a cetp inhibitor  (Millar Inc)
90
Millar Inc anacetrapib, a cetp inhibitor
Genotypic and allelic frequencies of −629C/A and 277C/T polymorphisms of <t> CETP gene </t> and their Hardy Weinberg Equilibrium analysis ( n = 402).
Anacetrapib, A Cetp Inhibitor, supplied by Millar Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anacetrapib, a cetp inhibitor/product/Millar Inc
Average 90 stars, based on 1 article reviews
anacetrapib, a cetp inhibitor - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
cetp-apob-100 transgenic mice  (Taconic Biosciences)
90
Taconic Biosciences cetp-apob-100 transgenic mice
Genotypic and allelic frequencies of −629C/A and 277C/T polymorphisms of <t> CETP gene </t> and their Hardy Weinberg Equilibrium analysis ( n = 402).
Cetp Apob 100 Transgenic Mice, supplied by Taconic Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cetp-apob-100 transgenic mice/product/Taconic Biosciences
Average 90 stars, based on 1 article reviews
cetp-apob-100 transgenic mice - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
male cetp apob  (Taconic Biosciences)
94
Taconic Biosciences male cetp apob
Genotypic and allelic frequencies of −629C/A and 277C/T polymorphisms of <t> CETP gene </t> and their Hardy Weinberg Equilibrium analysis ( n = 402).
Male Cetp Apob, supplied by Taconic Biosciences, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/male cetp apob/product/Taconic Biosciences
Average 94 stars, based on 1 article reviews
male cetp apob - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier
cetp-inhibitors  (Nissen)
90
Nissen cetp-inhibitors
Genotypic and allelic frequencies of −629C/A and 277C/T polymorphisms of <t> CETP gene </t> and their Hardy Weinberg Equilibrium analysis ( n = 402).
Cetp Inhibitors, supplied by Nissen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cetp-inhibitors/product/Nissen
Average 90 stars, based on 1 article reviews
cetp-inhibitors - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
cetp transgenic (b6.cba-tg(cetp)5203tall/j) mice  (Jackson Laboratory)
90
Jackson Laboratory cetp transgenic (b6.cba-tg(cetp)5203tall/j) mice
Genotypic and allelic frequencies of −629C/A and 277C/T polymorphisms of <t> CETP gene </t> and their Hardy Weinberg Equilibrium analysis ( n = 402).
Cetp Transgenic (B6.Cba Tg(Cetp)5203tall/J) Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cetp transgenic (b6.cba-tg(cetp)5203tall/j) mice/product/Jackson Laboratory
Average 90 stars, based on 1 article reviews
cetp transgenic (b6.cba-tg(cetp)5203tall/j) mice - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Sociodemographic Characteristics and CETP rs708272 Genotypes.

Journal: Nutrients

Article Title: Interaction of CETP rs708272 Polymorphism on Trans Fatty Acid Intake and Glucose Metabolism Markers

doi: 10.3390/nu16213683

Figure Lengend Snippet: Sociodemographic Characteristics and CETP rs708272 Genotypes.

Article Snippet: DNA samples were genotyped using TaqMan SNP genotyping assays (CETP rs708272, assay ID 4351379 C___9615318_10, Context Sequence [VIC/FAM] CTGAGACCCAGAATCACTGGGGTTC[A/G]AGTTAGGGTTCAGATCTGAGCCAGG, Thermo Fisher Scientific: https://www.thermofisher.com accessed on 12 September 2021) in a 96-well format, and analyzed with a Roche LightCycler 96 system (Roche, Mannheim, Germany).

Techniques:

Impact of CETP rs708272 genotypes on the interactions of baseline trans-fatty acid intake on glucose, insulin, and HOMA index. ( A ) Interaction between CETP rs708272 genotypes and baseline trans-fatty acid intake concerning the change (∆) in insulin. ( B ) Interaction between CETP rs708272 genotypes and baseline trans-fatty acid intake concerning the ∆ in glucose. ( C ) Interaction between CETP rs708272 genotypes and baseline trans-fatty acid intake concerning the ∆ HOMA-IR. The interactions were adjusted for age, sex, BMI, and total energy intake.

Journal: Nutrients

Article Title: Interaction of CETP rs708272 Polymorphism on Trans Fatty Acid Intake and Glucose Metabolism Markers

doi: 10.3390/nu16213683

Figure Lengend Snippet: Impact of CETP rs708272 genotypes on the interactions of baseline trans-fatty acid intake on glucose, insulin, and HOMA index. ( A ) Interaction between CETP rs708272 genotypes and baseline trans-fatty acid intake concerning the change (∆) in insulin. ( B ) Interaction between CETP rs708272 genotypes and baseline trans-fatty acid intake concerning the ∆ in glucose. ( C ) Interaction between CETP rs708272 genotypes and baseline trans-fatty acid intake concerning the ∆ HOMA-IR. The interactions were adjusted for age, sex, BMI, and total energy intake.

Article Snippet: DNA samples were genotyped using TaqMan SNP genotyping assays (CETP rs708272, assay ID 4351379 C___9615318_10, Context Sequence [VIC/FAM] CTGAGACCCAGAATCACTGGGGTTC[A/G]AGTTAGGGTTCAGATCTGAGCCAGG, Thermo Fisher Scientific: https://www.thermofisher.com accessed on 12 September 2021) in a 96-well format, and analyzed with a Roche LightCycler 96 system (Roche, Mannheim, Germany).

Techniques:

Genotypic and allelic frequencies of −629C/A and 277C/T polymorphisms of CETP gene and their Hardy Weinberg Equilibrium analysis ( n = 402).

Journal: Biochemistry and Biophysics Reports

Article Title: Deciphering the association of cholesteryl ester transfer protein (CETP) gene polymorphisms with high-density lipoprotein cholesterol (HDL-c) levels in the Bangladeshi population

doi: 10.1016/j.bbrep.2025.101992

Figure Lengend Snippet: Genotypic and allelic frequencies of −629C/A and 277C/T polymorphisms of CETP gene and their Hardy Weinberg Equilibrium analysis ( n = 402).

Article Snippet: The Human Protein Atlas revealed that the CETP gene is specifically expressed in the liver, adipose tissue, lymphoid tissue, and placenta.

Techniques: